A single nucleotide (G) was deleted from alternative exon 1 (from MetGlu codons ATGGAA) using sgRNAs (targeting ACAGCAGGTACGCAGCAGTATGG and CAGGTACGCAGCAGTATGGAAGG) and an ssODN template with CRISPR/Cas9 technology. This knockout mutation only affects the transcript encoding the shorter liver-specific L-isozyme, which uses an alternative 1st exon downstream from the longer R-isozyme encoding transcript's exon 1. (J:342736)