This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCGAGATGGATGAACACGT and CCTCAAATATCAGGGTGGGA, which resulted in a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147421,ENSMUSE00000147411, ENSMUSE00000147418, and ENSMUSE00000147415 (exons 5-8) and 2391 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early stop 50 amino acids later. (J:188991)