An integration of a HA tag at the 3 ' end of the coding region of Olig2 Cas9 protein was injected directly into the blastocysts, together with guide RNAs (cggccagcgggggtgcgtcc) and single-stranded DNA oligos of around 170 bp length, which carried the HA coding sequence flanked by sequences homologous to the region surrounding the natural stop codon of the corresponding gene. (J:343153)