Tmeff1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACTAGGCATCTCATTCAC and AATGTCAGATTACAAAACGG, which resulted in a 317 bp deletion beginning at Chromosome 4 position 48,604,417 bp and ending after 48,604,733 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000178348 (exon 2) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early stop 18 amino acids later. (J:188991)