This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTCCCTGTGCTGCTTGG and TGATCTCCCATTCTTAATGG, which resulted in a 545 bp deletion beginning at Chromosome 16 position 45,722,809 bp and ending after 45,723,353 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129242 (exon 2) and 370 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early stop 10 amino acids later. (J:188991)