Threonine codon 1522 (ACG) in exon 24 was changed to methionine (ATG) (p.T1522M) using a crRNA (targeting GGAAAACGTGAAACAGCGCC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.T1547M mutant (SNPs rs143331552) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Tmx3em1Jlp allele. (J:338889)