Valine codon 150 (GTC) in exon 4 was changed to isoleucine (ATT) (p.V150I) using a crRNA (targeting CCTCTGTGTGGCAGATGACT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human SNPs rs3748415 found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em1Jlp allele and created at the same time as the Asxl3em1Jlp allele. (J:338889)