Nfx1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGAATGTACGATAACAT and GTTGTCGCTTAACAAGAAGG, which resulted in a 313 bp deletion beginning at Chromosome 4 position 40,988,503 bp and ending after 40,988,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000344981 (exon 5) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 417 and early truncation 45 amino acids later. (J:188991)