Ankrd42^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAATCTCACCAGAATACTG and GTTAATGTGTTCAGATCAAT, which resulted in a 575 bp deletion beginning at Chromosome 7 position 92,619,292 bp and ending after 92,619,866 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001245987 (exon 5) and 439 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 2 amino acids later. (J:188991)