This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCACACCAGACAATGCCGC and GAGGTATTAGGATTATTACA, which resulted in a 719 bp deletion beginning at Chromosome 7 position 99,469,893 bp and ending after 99,470,611 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000264947 (exon 3) and 534 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 285 and early truncation 6 amino acids later. (J:188991)