CRISPR/cas9 genome editing used guide RNAS (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of a mutant exon 5 containing a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/Cas9 are inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with ZimmermannLaband Syndrome (VLS), a cranial malformation syndrome. (J:94077)