Eid3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGCTGCCATGCCAGACTC and CGTTATATCTTTGAGTTTAC, which resulted in a 998 bp deletion beginning at Chromosome 10 position 82,866,770 bp and ending after 82,867,767 bp (GRCm38/mm10). This mutation deletes 998 bp from ENSMUSE00001385020 (exon 1) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 10 amino acids later. (J:188991)