This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATACTCGTATTAGGTATTGA targeting the 5' side and TGTAAAGGCATCGTGAAAAC targeting the 3' side of a critical region (ENSMUSE00000176809, ENSMUSE00000176812 and ENSMUSE00000176807). This resulted in a 8050-bp deletion of Chr3 from 138181167 to 138189216 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)