Wdr5^em1.1Tcp

This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking three exons, ENSMUSE00001206138, ENSMUSE0000016411, and ENSMUSE00000164106 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region generate a null allele. (J:322048)