Gask1a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATTCTGCCTCTTGA and CCAAACGTGCCCACTCAGCA, which resulted in a 1160 bp deletion beginning at Chromosome 9 position 121,964,787 bp and ending after 121,965,946 bp (GRCm38/mm10). This mutation deletes 1160 bp from ENSMUSE00000633461 (exon 2) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 7 amino acids later. (J:188991)