This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTTCCAGTGATACCCGCA and TGTGTTTTCCACGGGCCATA, which resulted in a 2657 bp deletion beginning at Chromosome 10 position 76,767,806 bp and ending after 76,770,462 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244493 and ENSMUSE00001226971 (exons 13 and 14) and 2544 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 264 and early truncation 15 amino acids later. (J:188991)