This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCGTGTGCTATGTCGATGC targeting the 5' side and TGACCCATATCCGGGCACAT targeting the 3' side of a critical region (ENSMUSE00000391111). This resulted in a 1128-bp deletion of Chr8 from 76351357 to 76352484 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)