This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGTCCACCACAGATGGT and ACAGAGCTTGAGACTCCTAG, which resulted in a 1108 bp deletion beginning at Chromosome 16 position 8,663,387 bp and ending after 8,664,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129745 and ENSMUSE00000563877 (exons 2 and 3) and 797 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted result in a null allele. There is a 9 bp insertion (TCACTCACA)at the deletion site. (J:188991)