Fer1l6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCACCAGAGATGTAGAG and AGGAGAAGAGCGTAGCCACT, which resulted in a 635 bp deletion beginning at Chromosome 15 position 58,549,969 bp and ending after 58,550,603 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851953 and ENSMUSE00000870098 (exons 4-5) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 27 amino acids later. There is a single bp insertion (T) at the deletion site. (J:188991)