This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AACCTAGGGCAAGGCTCACG targeting the 5' side and CCACTTCATCCATACCCGGA targeting the 3' side of a critical region (ENSMUSE00000316305). This resulted in a 612bp deletion ofchr2: 157777029 to 157777640 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)