Del(Gm41148-Gm35360)14Zbch

CRISPR/cas9 genome editing uses two guide RNAs (GCTGCGATCCGAACAGTGAG and TCGATCCTCATACATTTCAT) to delete a 47 kb region of mouse chromosome 14, including both Gm41148 and Gm35360, (mm39 chr14:48,019,230-;48,066,441) which corresponds to the human long intergenic non-protein coding RNA 520 locus (LINC00520). This region is also referred to as enhancer-associated long non-coding RNA (lncRNA) that enhances endothelial nitric oxide synthase expression (LEENE).