Exons 10-12 were targeted with a modified BAC that contains an FRT site flanked neomycin resistance gene cassette in intron 9 and an exon 12 where leucine codon 466 (CTA) was changed to alanine (GCA) (p.L466A). Recombination was aided by CRISPR/Cas9 editing with an sgRNA (targeting GCATTGTTCACGGCAAGACTGG). The neo cassette was removed through subsequent Flp-mediated recombination. The mutation is the equivalent of the human p.L468A mutation that abolishes human MDM2 (HDM2)-mediated p53 multi-monoubiquitination and HDM2-MDM4 mediated p53 polyubiquitination. (J:325001)