This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTACGGGCTGAGGAAACGA and TGTAGGAGCGGAGCTCAAGT, which resulted in a 479 bp deletion beginning at Chromosome 12 position 83,977,736 bp and ending after 83,978,214 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000911225 (exon 3) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 307 and early truncation 23 amino acids later. (J:188991)