This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGGTGCGTTGAGATGATA targeting the 5' side and GCATAACTCCTCATCCTATG targeting the 3' side of a critical region (ENSMUSE00001147183). This resulted in a 147bp deletion of Chr9 from 54631312 to 54631458 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)