This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGAGACTAAAATAGTTCAG and GTTCACACGCTATAGGGCAG, which resulted in a 457 bp deletion beginning at Chromosome 17 position 3,162,731 bp and ending after 3,163,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000345755 (exon 5) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 3 amino acids later. There is a 4 bp insertion (CTTC) at the deletion site. (J:188991)