Phldb3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCTGATGACATCACTTGG and GCTCAGTTCTGGCTTCGGAT, which resulted in a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000890035, ENSMUSE00000890716, ENSMUSE00000499900, ENSMUSE00000891408, ENSMUSE00000479582 (exons 10-14) and 2714 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 384 and early truncation 34 amino acids later. (J:188991)