Endod1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTACTTTAGACAATTCCG and TGACCCTGACAGCAACCTCG, which resulted in a 1172 bp deletion beginning at Chromosome 9 position 14,356,695 bp and ending after 14,357,866 bp (GRCm38/mm10). This mutation deletes 1172 bp from ENSMUSE00000361525 (exon 2) and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 21 amino acids later. (J:188991)