This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGATACTGGGGTACACGG and CTAGGGAGATGTGTGAGATG, which resulted in a 1202 bp deletion beginning at Chromosome 7 position 5,017,385 bp and ending after 5,018,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000538365 (exon 2) and 151 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)