Reep3^em1(IMPC)Tcp

This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCTATACTGACTCCGG targeting the 5' side and GTCATAATCACTAAGAGGTT targeting the 3' side of a critical region (ENSMUSE00000367558 and ENSMUSE00000575837). This resulted in a 1,710-bp deletion of Chr10 from 66870185 to 66871894 (GRCm39). (J:265051)