This allele was generated at The Centre for Phenogenomics by electroporating Cpf1/Cas12a ribonucleoprotein complexes with single guide RNAs having spacer sequences of CUAAGGGCACACAUUGUAGGU targeting the 5' side and UUCAGACAUUCUUCAGACGCU targeting the 3' side of a critical region (ENSMUSE00001290156 and ENSMUSE00001223878). This resulted in a 2121-bp deletion of Chr4 from 11227066 to 11229186 with insertion of CCTTA (GRCm39). (J:200814)