This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCAGCCTAAGATCTCAT and GCAGAGCTTGTCCCAAAGCG, which resulted in a 4988 bp deletion beginning at Chromosome 4 position 43,032,325 bp and ending after 43,037,312 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362071, ENSMUSE00000342963, ENSMUSE00000390285, ENSMUSE00001303795, ENSMUSE00001252670, ENSMUSE00001212016, ENSMUSE00001285070, ENSMUSE00001213061 (exons 2-9) and 2031 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to result in a null allele. (J:188991)