Tgm7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAACTGTTAGCTAACAAA and TAGATTTTGTTGCTAGCCTC, which resulted in a 417 bp deletion beginning at Chromosome 2 position 121,106,807 bp and ending after 121,107,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000684906 (exon 4) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 146 and early truncation 1 amino acid later. (J:188991)