This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGCTTTGGTAGTAGATAA and TGTTCATAGAAAATGCTTCT, which resulted in a 1098 bp deletion beginning at Chromosome 13 position 111,255,161 bp and ending after 111,256,258 bp (GRCm38/mm10). This mutation deletes 1098 bp from ENSMUSE00000490725 (exon 1) and is predicted to result in an early termination after amino acid residue 10. (J:188991)