Atoh1^em2Zyliu

The gene was targeted with an sgRNA (targeting CGCGCGCTAGGAAGGGCATT) and a double strand DNA template using CRISPR/Cas9 technology to insert the following immediately upstream of the stop codon in the single-exon gene: three copies of sequence coding for a V5 epitope tag, sequence coding for the P2A self-cleaving peptide and the tdTomato fluorescent reporter gene. This allele will express both the endogenous gene, with C-terminal V5 tags, and the reporter gene. (J:333396)