This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTGAGAAGAGTGATGAG and CAAACAGAGCTTGTATTAGC, which resulted in a 1450 bp deletion beginning at Chromosome 7 position 67,617,757 bp and ending after 67,619,206 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200384, ENSMUSE00000200380 (exons 4 and 5) and 1274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 13 amino acids later. (J:188991)