This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGAGAATAGTTAAGCGT and GTCCATGTCCATGAAACAGA, which resulted in a 409 bp deletion beginning at Chromosome 11 position 9,027,775 bp and ending after 9,028,183 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257022 (exon 6) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 128 and early truncation 23 amino acids later. (J:188991)