This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGATCAAGAGGCAATACG and GGAGTCTCTTTAAATGACGG, which resulted in a 1220 bp deletion beginning at Chromosome 16 position 49,069,183 bp and ending after 49,070,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000902859, ENSMUSE00000880398 (exons 4 and 5) and 1035 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 25 amino acids later. (J:188991)