Fscn3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCAATTAGCACAGCCAAG and GGAGAAAGTATGTCTAGGCA, which resulted in a 263 bp deletion beginning at Chromosome 6 position 28,431,420 bp and ending after 28431682 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000191890 (exon 3) and 144 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 280 and early truncation 8 amino acids later. (J:188991)