Cfap20dc^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAAACATTAATTGCAAG and AATTTCACCAGTGCCCCAAG, which resulted in a 442 bp deletion beginning at Chromosome 14 position 8,644,284 bp and ending after 8,644,725 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000305379 (exon 4) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 4 amino acids later. (J:188991)