This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATGCATGTAAGGTCACAA and AAGAATCCCTGTCAGCTGCG, which resulted in a 328 bp deletion beginning at Chromosome 1 position 121,441,594 bp and ending after 121,441,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261988 (exon 4) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 2 amino acids later. (J:188991)