CRISPR/Cas9 technology, using an sgRNA (targeting ACTTCTTCCGGAATGCACTG) and an ssODN template, generated a TGG to GCA change resulting in a tryptophan to alanine substitution at amino acid 232 (p.W232A) in exon 10. This change prevents interaction with PEST phosphatases. In addition, sequence of NsiI restriction cleavage site was introduced by changing a C to T in the ATGCAC sequence. Western blot analysis indicated reduced protein levels in neutrophil lysates compared to wild-type protein levels. (J:332442)