Pstpip2^em3Tbrd

CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a single nucleotide insertion (an A) into the codon of the first C-terminal tyrosine (Y323) and created a stop codon resulting in the loss of the last 12 amino acids (323-334). Western blot analysis indicated only low amounts of protein in neutrophil lysates, about 20-25% of wild-type levels. (J:332442)