This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATATGTGCAAAAGATACCA and TGGAGGATAGATATACCACA, which resulted in a 383 bp deletion beginning at Chromosome 11 position 120,716,830 bp and ending after 120,717,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000148250 (exon 7) and 270 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 220 and early truncation 18 amino acids later. (J:188991)