This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCATTTCTTTGAAGAAG and ACAGTGCTGAGGGCAGTGTG, which resulted in a 277 bp deletion beginning at Chromosome 14 position 60,281,868 bp and ending after 60,282,144 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558120 (exon 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 101 and early truncation 2 amino acids later. There is a single bp A insertion at the deletion site. (J:188991)