B4galt4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGGTTGTAATCGGAGCCG and TTGCCCATACTCTTATTAGA, which resulted in a 807 bp deletion beginning at Chromosome 16 position 38,753,882 bp and ending after 38,754,688 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130477 (exon 3) and 574 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 3 amino acids later. (J:188991)