Mrpl39^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGACTCCCGATGATTTAGA and GTTAAAAATGACTTTGCATG, which resulted in a 600 bp deletion beginning at Chromosome 16 position 84,732,127 bp and ending after 84,732,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000131646 (exon 3) and 460 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 20 amino acids later. (J:188991)