This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACACTCCTGAGAATGTT and CTTTTGTCATCCAAGTTGGA, which resulted in a 524 bp deletion beginning at Chromosome 13 position 96,420,527 bp and ending after 96,421,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289218 (exon 13) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 423 and early truncation 21 amino acids later. (J:188991)