Guk1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATAGCTGATAGGCTCCA and CATAGCAGTCCTGTGTAGGG, which resulted in a 429 bp deletion beginning at Chromosome 11 position 59,185,683 bp and ending after 59,186,111 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000104732 (exon 4) and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 10 amino acids later. (J:188991)