Ankrd60^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTTGATAAGCAAGCCCGA and GCGTGATTCAGGGCCAGACG, which resulted in a 360 bp deletion beginning at Chromosome 2 position 173,572,334 bp and ending after 173,572,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273680 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 20 amino acids later. (J:188991)