This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGTTACACAAGGAAAAGA and TTACTTTGGAGAGCTTCCCA, which resulted in a 441 bp deletion beginning at Chromosome 7 position 92,568,372 bp and ending after 92,568,812 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000201319 (exon 3) and 337 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 23 amino acids later. (J:188991)